kelcisizemore kelcisizemore
  • 02-11-2015
  • English
contestada

which one of the following is a correct spelling of a plural noun.
A) buffaloes B) oxes C) gooses D) knifes

Respuesta :

ArielfrmDc ArielfrmDc
  • 02-11-2015
the answer is A) buffaloes
Answer Link

Otras preguntas

How many times does four go into 153 ? What Is the remainder ?
A tabletop in the shape of a trapezoid has an area of 6,550 square centimeters. Its longer base measures 115 centimeters and the shorter base is 85 centimeters.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
An archer’s arrow follows a parabolic path. The height of the arrow f(x) is given by f(x) = -16x^2 + 200x + 4, in feet. Find the maximum height of the arrow.
Gina rented shoes, bowled 3 games, and bought 1 order of nachos. she used a coupon for 1/2 off the price of her bowling games. What was Ginas total cost before
what is 0.00001267 is scientific notation
When 40 is added to the number of miles Karen ran last week, the result is the same as adding 10 to 4 times the number of miles she ran last week. How many mile
In which sentence does the prepositional phrase act as an adverb? A. Last evening, Anne suffered from a headache. B. The door to the attic was left open. C. Mr
Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.
Where did middle names come from