darylisbae12 darylisbae12
  • 02-10-2017
  • History
contestada

during the French Revolution the new assembly of the people is called the?

Respuesta :

rileymf
rileymf rileymf
  • 02-10-2017
they were called the National Assembly
Answer Link

Otras preguntas

all 231 students in the math club went on a field trip. some students rode in vans ehich hold 7 students each and some students rode in buses which hold 25 stud
Please help me!!!!!!!!!!!!!!!!!!!!! Arusha draws a rectangular prism that is made up of two connected cubes, each with side length e. The surface area of a cert
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Which powerful religious group often tried to close the theaters in Shakespeare's time? A. the Puritans B. the King's Men C. the Pilgrims D. the Jacobites
31+34=90-n 45+1=70-k 6×9=41+m
which point is in the solution set to the system of inequalities: y>2x-1 and y<1/2x+5
Can someone answer my question plz!!!! It's in the picture and show your work!!!!!
which of these was a result of the treaty of Brest-Litovsk? A. The end of world war 1 B. Russia's withdrawal from the war C. The end of Austria-Hungrays war w
4(3-5)=-2(8-z)-6z what is z
Jimmy pays $2.93 for each gallon of gas. Which table best represents the relationship between g, the number of gallons purchased, and m, the amount he pays for