jjbraveboy jjbraveboy
  • 04-04-2022
  • Mathematics
contestada

linear exponential function

y=5.3×​

Respuesta :

doreennnyathi
doreennnyathi doreennnyathi
  • 05-04-2022

Answer:

y=5x

which means 3 will be dedicated to 5

so 5=3y

Answer Link

Otras preguntas

"Sophie Gonzalez" Hola Sandra, ¿Cómo estás? Yo estoy muy bien. Bueno, ahora (I study) (Spanish). También me gusta (to dance) y (to sing) (I dance) todo tipo de
what are two favorite classes you like and why
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
12. Based on the pattern below, what would you expect the next block to look like? O
when an organization produces only a single product and attempts to sell it to two or more market segments, it avoids which costs?
When water evaporates, what happens to its molecules? 1. The water molecules stay the same they just change phase to a gas. 2. Some of the water molecules stay
A right triangle has two legs with lengths of 5 inches and 12 inches. What is the lenght of the hypotence
Un tinaco tiene un volumen de 750 L. Conviértelo a metros cúbicos
Which substance will form a solution with water? (Select all that apply.) sugar string sand salt
was the feels by twice really worth it ?​