lavenderleah lavenderleah

02-10-2021
Mathematics

contestada

Find the sum of all values of the digit X such that 39504X2 is divisible by 4.

Respuesta :

pilger48023 pilger48023

09-10-2021

Answer:

25

Step-by-step explanation:

Answer Link

16kell12 16kell12

31-05-2022

Answer:

25

Step-by-step explanation:

Answer Link

Otras preguntas

NEED HELP PLEASE WORTH 15 POINTS Which equation would best help solve the following problem? The height of a triangle is 4 m less than its base. The area of the

When citizens _______, they help elect people who carry out government tasks. A. vote B. volunteer C. lobby D. nominate

The oxygen moves into the blood system from the lungs by the process. A.Exhalation B.Osmosis C.Diffusion D.Respiration

Which two states were admitted to the united states as part of the missouri compromise?

What was a major effect of the agricultural revolution in the united states during the late 1800's?

Multivitamin/mineral supplements should never be given to toddlers. a. True b. False

Help! Exponential Equation WITHOUT CALCULATOR

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

How do you find the length of the hypetnyuse if you have one angle and opposite side?

Help me please im about to give up