katsu2230 katsu2230

02-09-2021
Physics

contestada

A water tank measures 2 m X 4m x 5 m.
What mass of water will it contain?

Respuesta :

02-09-2021

Answer:

1 L = 1000 cm^3

1 m^3 = 1000 L = 10^6 cm^3

1 m^3 = 10^6 g = 10^3 kg density of water

M = Density * Volume

V = 2 * 4 * 5 = 40 m^3

M = 10^3 kg / m^3 * 40 m^3 = 4.0 * 10^4 kg

Answer Link

Otras preguntas

What is the lowest level of measurement that a median can be computed?

What type of government did germany, italy, and japan have in the 1930s? (world war ii and postwar america unit, lesson 1)?

the world-systems approach argues that peripheral nations exploit core nations in various ways True or False

1. Read the paragraph below. When Tyrese dropped his crutches and limped to the starting block, the audience froze. Then the starter’s signal sounded, and the s

3m2+7=55 answer please

Help with geometry!!!

Using the point-slope equation, find the equation containing (-2, -4) and slope m = -1

Will bought a package of 24 juice bottles for $7.44. Which equation relates the cost, c, of a package of juice bottles to the number of bottles, b, in the packa

Carl earned $6.20 per hour and worked 6 1/2 hours per day. What is the best estimate of his earning for a five-day work week?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat