cassiemance243
cassiemance243 cassiemance243
  • 02-12-2016
  • Mathematics
contestada

I surrender !!! Can someone guide me in this problem ?:(

9^-1 9^1/2

Respuesta :

Dymomite Dymomite
  • 02-12-2016
any number to the power of a negative number must be flipped to its recipical. Hence it would be 1 ninth or 1/9 x 9 to the power of one half.
anything powered to one half is a square root. That being said your expression would be 1/9 × the square root of 9.
9 is a perfect square to it would be three
1/9 × 3/1 is 1/3 when cross canceled. your answer is 1/3. Hoped that helped.
Answer Link

Otras preguntas

one-third of the fish in Liam's fish tank were added today. Half of the other fish were a gift to Liam last week. the other 9 came from Liam's old fish tank.
what might be learned from an incorrect hypothesis
What property is shown by the equation? 1. 0 ÷ (–6) = 0
What is the primary purpose of the Supremacy Clause?
Which theater is considered Shakespeare's theater? A. The Swan B. The Globe C. The Rose D. The Stage
Why did we use coin-flipping as a method to choose traits for the parent pets and the offspring pets?
which point is in the solution set to the system of inequalities: y>2x-1 and y<1/2x+5
On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor
Where did middle names come from
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5