GheSe1l9leneesusafir GheSe1l9leneesusafir
  • 03-11-2016
  • English
contestada

What is the difference between genre and theme?

Respuesta :

Аноним Аноним
  • 08-11-2016
Theme is the way of expressing the place or area you are. Genre is writing of expressing yourself in writing. I hope this helps I looked it up.
Answer Link

Otras preguntas

does a human body use neon???
what was paul revere failures
does radiation need a phase of matter to travel with?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
an explanation describe if an orange pet mates with another orange pet, can they have any green offspring.
as an allied health worker the single most important thing you can do to prevent the spread of disease is A. take antibiotics B. use antibacterial gel C. wash
Step by step directions Square root for 480
which point is in the solution set to the system of inequalities: y>2x-1 and y<1/2x+5
When 40 is added to the number of miles Karen ran last week, the result is the same as adding 10 to 4 times the number of miles she ran last week. How many mile
all 231 students in the math club went on a field trip. some students rode in vans ehich hold 7 students each and some students rode in buses which hold 25 stud