oaktreetrash oaktreetrash
  • 03-02-2021
  • Mathematics
contestada

Which expression is equivalent to (2^3)^-5

Which expression is equivalent to 235 class=

Respuesta :

bajskskakaajjaj
bajskskakaajjaj bajskskakaajjaj
  • 03-02-2021
1. The one you answered
Answer Link

Otras preguntas

Solve for x. 8 6 X A 100 В 10 С 5.3 D 14
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
Plz help I have 7 more minutes to turn it in will mark u BRAINLY and give u points!
How will the graph of the function f(x)=3^x translate the function is changed to f(x)=3(x-2)
Tom puts a metallic cover over his car's windshield after parking. How does this control the sun's rays during a sunny day?
HELP ASAP I WILL MARK BRAINLIST!!!!
Which of the following statements describes the cost of capital? A. The interest rate the bank charges its best customers. B. The internal rate of return on in
help me please bddbdbbdbd​
Which number comes first if the numbers 2.001, 0.0035, 0.0005, 4.56094 are arranged in order from most to fewest significant digits? A. 0.0005 B. 0.0035 C. 2
Science (from the Latin word Scientia, meaning "knowledge") is a systematic enterprise that builds and organizes knowledge in the form of testable explanations