nanilyann nanilyann
  • 02-02-2021
  • Biology
contestada

how do cells compare in size to things like rice and salt ?

Respuesta :

scholar78 scholar78
  • 02-02-2021
Cells are the building blocks for all living things meaning they are really tiny .
Answer Link

Otras preguntas

which of these was a result of the treaty of Brest-Litovsk? A. The end of world war 1 B. Russia's withdrawal from the war C. The end of Austria-Hungrays war w
p(x) x^3+x^2-x-1 Find all zeros of p (x)
Which of the following is NOT a form of formal debate? A. an argument B. policy debate C. parliamentary debate D. Lincoln-Douglass debate
How many combinations of 5 students can a teacher choose from 24 students? A. 5,100,480 B. 42,504 C. 7,962,624 D. 120
What are the qualities of a good topic? How will you ensure the topic you choose is relevant and interesting?
What were the driving forces behind the industrial revolution
who was the founder of Pennsylvania?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
how many 1 1/2 centimeter cubes can fit into a rectangular prism that has a length of 12 centimeters , a width of 6 centimeters and a height of 9 centimeters
when Jefferson took office he did what