zachspencer10
zachspencer10 zachspencer10
  • 03-03-2020
  • Mathematics
contestada

find the horizontal asymptote of the graph of y= -2x^6+5x+8/8x^6+6x+5

a: y= -1/4

b: y=0

c= y=1

D= no horizontal asymptote

NEED HELP ASAP!!!!

Respuesta :

amna04352
amna04352 amna04352
  • 03-03-2020

Answer:

a) y = -¼

Step-by-step explanation:

(-2x^6+5x+8)/(8x^6+6x+5)

Just divide the leading coefficients

-2/8 = -¼

Horizontal asymptote:

y = -¼

Answer Link
ayankhan450
ayankhan450 ayankhan450
  • 03-03-2020

Answer:a) y = -¼

Step-by-step explanation:

(-2x^6+5x+8)/(8x^6+6x+5)

Just divide the leading coefficients

Answer Link

Otras preguntas

NEED HELP BADLY!! A car with an initial velocity of 22 m/s is accelerated at a rate of 7.3 m/s/s for 6.8 seconds. What is the cars final velocity?
The California Gold Rush Write a journal about your experience as a 49er searching for gold in California.
Paragraph What led to the creation of the first professionally organized police forces in the United States?
(1/4)x+1=32 -A: -7/2 -B: 2 -C: -2 -D: 3/2
dentify all the pairs of vertical angles in the figure. Pair#1: Pair#2
What goes in hard but comes out soft and smooth?
What is the least common multiple of 10 and 7
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
What did Hitler believe he had failed in Czechoslovakia?
which of these statements is true ?