rlspike1
rlspike1 rlspike1
  • 01-06-2018
  • Mathematics
contestada

i dont know how but can someone help me asap if i get it wrong i fail the grade

i dont know how but can someone help me asap if i get it wrong i fail the grade class=

Respuesta :

ashlen005
ashlen005 ashlen005
  • 01-06-2018
i am not sure but i think it is $380
Answer Link

Otras preguntas

Which word has the long i sound? relieve speciality society social
according to the United States constitution the president has the power to (A) negotiate treaties (B) amend the constitution (C) impeach members of congress
Which sentence does not contain any errors in comma usage? A. If you ever visit New Haven, Connecticut, be sure to eat at Sally's Pizza. B. The original Londo
what is the position of 9 in the number 932,805? A. The ten-thousands place B. The hundred-thousands place C. The hundreds place D. The ones place
a summary about concussions
does radiation need a phase of matter to travel with?
In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Graph the six terms of a finite series where a1 = -3 and r = 1.5.
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y