yradf8430 yradf8430
  • 01-06-2018
  • History
contestada

How long does it take to sail from japan to california?

Respuesta :

stupidgirllx stupidgirllx
  • 01-06-2018
about 10 to 14 days depends where in Japan or california
Answer Link

Otras preguntas

Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea
Please help me with this two step math problem! THANK YOU !!!!!!!!
(3x^2 + 2x -2) + ( -2x^2 + 5x+5) My answer 5x^2 + 7× +7 Am i right
Which is one type of play that Shakespeare wrote? A. histories B. musicals C. passion plays D. burlesques Question Resources
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
Please help with math question and please show ALL work. 1....How many solutions does the equation 3x+x+3=2(2x+1)+1 have? 2...How many solutions does the pair
An archer’s arrow follows a parabolic path. The height of the arrow f(x) is given by f(x) = -16x^2 + 200x + 4, in feet. Find the maximum height of the arrow.
_______ is the largest continental biome. It experiences long, cold winters; short, mild summers; and low precipitation. It is characterized by coniferous fore
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Companies raise funds to expand their business by